• Streptozocin br This study has a number

  2022-05-10

  

  This study has a number of strengths. The Sister Study is a large, prospective cohort, which provided sufficient study power to examine the main air toxic-breast cancer associations as well as modification of these associations by obesity and physical activity. Additionally, these Sister Study parti

• Cellular Signalling br RNA extraction and quantitative real

  2022-05-09

  

   Cellular Signalling 62 (2019) 109350 2.6. RNA extraction and quantitative real-time polymerase chain reaction (qPCR) Total RNA was extracted using RNeasy Mini Kits (QIAGEN, Germany), according to the manufacturer's protocol. Total RNA (1 μg) was reverse-transcribed into cDNA using a QuantiT

• L-Glutamine br Competing interests br The authors have declared

  2022-05-09

  

  Competing interests The authors have declared that no competing interest exists. Acknowledgements 21576042). The authors thank Life Science Research Core Services (LSRCS), Northwest A&F University for help with characterizations including SEM and CLSM. The authors thank Shiyanjia Lab (www

• US br Bladder Area mm br Fig Scatter

  2022-05-06

  

  US Bladder Area (mm2) Fig. 2. Scatter plots demonstrating the relationship between HG-9-91-01 size (measured as the area of the bladder on a central sagittal slice) and the median observer contour confidence rating for cone beam computed tomography images (top) and ultrasound images (bottom).

• br Kou T Kanai M Yamamoto M Xue P Mori

  2022-05-06

  

  [38] Kou T, Kanai M, Yamamoto M, Xue P, Mori Y, Kudo Y, et al. Prognostic model for survival based on readily available pretreatment factors in patients with advanced pancreatic cancer receiving palliative chemotherapy. Int J Clin Oncol 2016;21:118–125. [39] Lee BM, Chung SY, Chang JS, Lee KJ,

• br A Zdun Ryzewska G

  2022-05-04

  

  A. Zdun-Ryzewska,˙ G. Chojnacka-Szawłowska and K. Basinski´ et al. / Current Problems in Cancer xxx (xxxx) xxx  3 Methods The following instruments were used. The Illness Perception Questionnaire The Illness Perception Questionnaire was designed to asses beliefs about chronic pain a

• br Recent advantages in nanoscience and nanotechnology may provide

  2022-05-04

  

  Recent advantages in nanoscience and nanotechnology may provide an alternative strategy for the above-mentioned issues [11,12]. Examples include the use of nanosized brush-arm star polymers [13], polysaccharide-based nanoparticles [14], chitosan derivatives [15], mesoporous silica nanoparticles [1

• br Keywords br Cancer stem cell br Claspin br Gastric

  2022-05-04

  

  Keywords: Cancer stem cell; Claspin; Gastric cancer; Spheroid  Summary Gastric cancer (GC) is one of the leading causes of cancer-related death worldwide. Spheroid colony formation is a useful method to identify cancer stem Angiotensin I (CSCs). The aim of this study was to identi

• Coexisting KRAS p A T and NRAS p Q R

  2022-04-29

  

   Coexisting KRAS p.A146T and NRAS p.Q61R mutations were detected in CRC0125. Pyrosequencing, however, showed only the KRAS mutation from 5 subareas. NGS repeated on the originally examined DNA sample and on DNA samples from 2 subareas also showed only KRAS p.A146T. The results indi-cate that the N

• SC 560 br Conclusions The implementation of new lung cancer screening guidelines

  2022-04-29

  

  Conclusions: The implementation of new lung cancer screening guidelines did not change clinical practice in the management of patients with LC and many patients do not receive recommended screening. Further study concerning potential barriers to effective evidence-based screening and coordination o

• br Although the Liao et al trial showed no difference

  2022-04-29

  

  Although the Liao et al. trial showed no difference in primary endpoints, we caution against concluding that proton therapy has no benefit in NSCLC. Among patients who were not eligible for randomization, PSPT was the only modality that could meet dose constraints in 13 patients, illustrating that

• br Clinical Characteristics Molecular Phenotyping and

  2022-04-29

  

  Clinical Characteristics, Molecular Phenotyping, and Management of Isolated Adrenal Metastases From Lung Cancer Antonio Mazzella,1 Mauro Loi,2 Audrey Mansuet-Lupo,3 Antonio Bobbio,1 Helene Blons,4 Diane Damotte,3 Marco Alifano1 Abstract Adrenal involvement is frequent in metastatic nonesm

• Paclitaxel br There is a crucial need for

  2022-04-28

  

  There is a crucial need for effective strategies for real-time monitoring during pancreatic cancer treatment, to identify chemorefractory status and direct therapy. NEW FINDINGS Serial quantitative measurements of circulating nucleic Paclitaxel sources can provide clinically relevant predic

• br Blood collection and miRNA extraction br

  2022-04-28

  

  2.2. Blood collection and miRNA extraction A blood sample was collected from each patient before treatment start. Blood samples were collected in 10 ml EDTA tubes and Dalbavancin was isolated by centrifugation at 1850 g for 9 min. There was no sign of hemolysis in any of the blood samples. Plas

• br shNC GUACCUGACUAGUCGCAGAUU br shcircMTO GUGGGACAGAAAUUAUAAU br Cell transfection

  2022-04-27

  

  shNC: 5′-GUACCUGACUAGUCGCAGAUU-3′ shcircMTO1: 5′-GUGGGACAGAAAUUAUAAU-3′ 2.3. Cell transfection The S100A1 cDNA was subcloned into pcDNA3.1 vector and transfected into cells using lipofectamine 2000 (Life Technologies). For miR-6893 mimic or inhibitor transfection, we used LipofectamineVR

179 records 5/12 page Previous Next 12345 Next 5 pages Last page