Archives

  • 2022-09
  • 2022-08
  • 2022-07
  • 2022-06
  • 2022-05
  • 2022-04
  • 2021-03
  • 2020-08
  • 2020-07
  • 2020-03
  • 2019-11
  • 2019-10
  • 2019-09
  • 2019-08
  • 2019-07
  • br The gene assay was carried

    2022-09-13


    The 21-gene assay was carried out, using a formalin-fixed, paraffin-embedded surgical specimen, by Genomic Health, Redwood City, 
    Table 1
    Primers and probes used in 21gene assay.
    Proliferation group
    CCNB1 CTCCACAGTCAGACCCAG GCACGCTAAGAGTTCTCC MKI67 AGGCTCAGCGGGTCTTGT AACCGGCTTGTGACTGGA MYBL2 TACGCCTGTAATACCAGCAC AAGCGCAACCGGACGAAT STK15 CGGGAAGTCACTGGAAAC CTCCTGCAACAACCTGAA BIRC5 AGGGAGGACAGACAATGCT CTTTGGACTCGCTCAAGAA Invasion group
    CTSL2 GGTGGCAGCCCATGAATT GGTAGCGAAAGGTGTAGAAGG MMP11 TACAGCCAAGGGAAACAT GAAAGCAACCCATCATCT Her 2 group
    GRB7 CCCACTGACTTCGGTTTCT GTGCGGCTCTGCTCATCT HER2 GAGTCCATGCCCAATCCC CCCACGTCCGTAGAAAGGT ER group
    ESR1 TGCCAAGGAGACTCGCTAC AGCCCTCACAGGACCAGA PGR GCTGCGGTGGAGGTTGAGGA ACCCAGAGCCCGAGGTTTGC BCL-2 CTTCGCCGAGATGTCCAG CCAGTTCACCCCGTCCCT SCUBE2 ATGGGAGGAGCTGCCTTGA CGCCGTTTCACCCGTTTA Related genes
    GSTM1 GACGCTCCTGATTATGACA TCAAGTAGGGCAGATTGG BAG1 ATCTTGGAGGAGATTGACA AGGAATGCCTGAACCTTT CD68 CTTTGCTGCCATCCTTCA TTGTGGCTCTTGGTAGTCC Reference genes
    ACTB TTCCAGCCTTCCTTCCTG CTTTGCGGATGTCCACGT GAPDH ATCATCAGCAATGCCTCC TCCTTCCACGATACCAAAG RPLPO GGTCATCCAGCAGGTGTT CCTCCAGGAAGCGAGAAT GUS CCACGGTGTCAACAAGCA ACCAAGCCAGCGAAGCAG TFRC CACCATCTCGGTCATCAG TCCATATTCCCAAACAGC
    California, USA. The forward primer (5′-3′) and reverse primer (5′-3′) used EPZ-6438 listed in Table 1. The RS score was calculated as previously reported, and was reported on a scale from 0 to 100 (Paik et al., 2004). Patients with RS < 18 were classified as low risk, patients with RS from 18 to 30 were classified as intermediate risk, and patients with RS > 30 were classified as high risk.
    3.1. Statistical analysis
    Microsoft Excel 2013 was used for data collection. The description method was used to analyze the distribution of conventional clinical indexes, whereas continuous outcomes were expressed as the means ± standard deviation (SD). Statistical analysis was performed using the SPSS 22.0 statistical software package (SPSS Inc., Chicago, IL). RS results between clinicopathological characteristics and the choice of adjuvant therapy were compared using the χ2 analysis of variance. Multivariable logistic analysis was then proceeded to in-vestigate the independent risk factors. All tests were two-sided, with a 0.05 level of significance.
    4. Results
    4.1. Participants
    Table 2
    Baseline characteristics.
    Items Data Items Data
    Age
    Molecular subtype
    E-cadherin
    RS score
    Pathology
    carcinoma
    AR
    scores were 14, 22, and 37, respectively. The gene expression did not translate to expression of those markers by IHC.
    5. Relationship between RS and clinicopathological features
    6. Multivariable logistic analysis results
    Regarding RS value as a dependent variable, logistic analysis results demonstrated that tumor size (P = 0.033) and histological grade
    7. Correlation between RS score and chemotherapy decision-making
    Next, we investigated the effect of RS on adjuvant chemotherapy decision-making. Overall, chemotherapy selection was correlated with the RS value. As shown in Table 5, the proportion of chemotherapy in the intermediate/high risk groups were was higher than that in the low risk group, P < 0.001. Before 21-gene assessment, based on the Chi-nese guideline and NCCN guideline, 169 (76.1%) patients with high risk preferred adjuvant chemotherapy plus endocrine therapy; 23.9% of those evaluated with lower recurrence risk chose endocrine therapy alone, which was recommended by the physicians. However, after RS evaluation, 51/169 (30.2%) patients changed the treatment regimen from adjuvant chemotherapy plus endocrine therapy to endocrine treatment alone, based on the physicians' recommendations (Fig. 2). No patients were advised to add adjuvant chemotherapy.